Review



lc3 crispr cas9 knockout plasmids  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Santa Cruz Biotechnology lc3 crispr cas9 knockout plasmids
    Fig. 6 Effect of autophagy on CS-mediated NLRP3 Inflammasome inhibition in N. gonorrhoeae-infected macrophages. In panel A, J774A.1 macrophages were pre-incubated with CS or a vehicle in the presence or absence of 5 mM 3-MA for 0.5 h before N. gonorrhoeae infection, followed by an additional 24- hour incubation period. Levels of IL-1β in the supernatants were measured through ELISA. In panel B, wild-type or <t>LC3-knockdown</t> J774A.1 macrophages were incubated with 100 nM rapamycin or a vehicle for 4 h, and the levels of LC3 in the cell lysates were assessed via Western blotting. In panels C-E, wild- type or LC3-knockdown J774A.1 macrophages were pre-incubated with either CS or a control vehicle for 0.5 h before N. gonorrhoeae infection, followed by an additional 24-hour incubation period. The concentrations of IL-1β (C) and IL-6 (E) in the supernatants were measured through ELISA, while the levels of caspase-1 in the supernatants were assessed through Western blotting (D). The ELISA data are presented as the mean ± SD of three independent experiments. The presented Western blotting images represent individual experiments. Statistical significance is indicated as ***p < 0.001 as indicated
    Lc3 Crispr Cas9 Knockout Plasmids, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sc+417828/MAP+LC3%CE%B2+HDR+Plasmid/pm39578786-47-16-26
    Average 93 stars, based on 5 article reviews
    lc3 crispr cas9 knockout plasmids - by Bioz Stars, 2026-10
    93/100 stars

    Images

    1) Product Images from "Exploring Candesartan, an angiotensin II receptor antagonist, as a novel inhibitor of NLRP3 inflammasome: alleviating inflammation in Neisseria gonorrhoeae infection."

    Article Title: Exploring Candesartan, an angiotensin II receptor antagonist, as a novel inhibitor of NLRP3 inflammasome: alleviating inflammation in Neisseria gonorrhoeae infection.

    Journal: BMC infectious diseases

    doi: 10.1186/s12879-024-10208-3

    Fig. 6 Effect of autophagy on CS-mediated NLRP3 Inflammasome inhibition in N. gonorrhoeae-infected macrophages. In panel A, J774A.1 macrophages were pre-incubated with CS or a vehicle in the presence or absence of 5 mM 3-MA for 0.5 h before N. gonorrhoeae infection, followed by an additional 24- hour incubation period. Levels of IL-1β in the supernatants were measured through ELISA. In panel B, wild-type or LC3-knockdown J774A.1 macrophages were incubated with 100 nM rapamycin or a vehicle for 4 h, and the levels of LC3 in the cell lysates were assessed via Western blotting. In panels C-E, wild- type or LC3-knockdown J774A.1 macrophages were pre-incubated with either CS or a control vehicle for 0.5 h before N. gonorrhoeae infection, followed by an additional 24-hour incubation period. The concentrations of IL-1β (C) and IL-6 (E) in the supernatants were measured through ELISA, while the levels of caspase-1 in the supernatants were assessed through Western blotting (D). The ELISA data are presented as the mean ± SD of three independent experiments. The presented Western blotting images represent individual experiments. Statistical significance is indicated as ***p < 0.001 as indicated
    Figure Legend Snippet: Fig. 6 Effect of autophagy on CS-mediated NLRP3 Inflammasome inhibition in N. gonorrhoeae-infected macrophages. In panel A, J774A.1 macrophages were pre-incubated with CS or a vehicle in the presence or absence of 5 mM 3-MA for 0.5 h before N. gonorrhoeae infection, followed by an additional 24- hour incubation period. Levels of IL-1β in the supernatants were measured through ELISA. In panel B, wild-type or LC3-knockdown J774A.1 macrophages were incubated with 100 nM rapamycin or a vehicle for 4 h, and the levels of LC3 in the cell lysates were assessed via Western blotting. In panels C-E, wild- type or LC3-knockdown J774A.1 macrophages were pre-incubated with either CS or a control vehicle for 0.5 h before N. gonorrhoeae infection, followed by an additional 24-hour incubation period. The concentrations of IL-1β (C) and IL-6 (E) in the supernatants were measured through ELISA, while the levels of caspase-1 in the supernatants were assessed through Western blotting (D). The ELISA data are presented as the mean ± SD of three independent experiments. The presented Western blotting images represent individual experiments. Statistical significance is indicated as ***p < 0.001 as indicated

    Techniques Used: Inhibition, Infection, Incubation, Enzyme-linked Immunosorbent Assay, Knockdown, Western Blot, Control

    Related Articles

    Knock-Out:

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy
    Article Snippet: EGFP-LG3B , Karla Kirkegaard (Addgene plasmid # 11546) , RRID:Addgene_11546. .. MAP-LC3β2 GRISPR/Gas9 knockout plasmids (Human) , Santa Cruz Biotechnology , Cat# sc-417828, sc-417828-HDR. .. CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) , Origene , Cat# KN2G6379.

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.
    Article Snippet: .. Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS ..

    Recombinant:

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.
    Article Snippet: .. Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS ..

    Plasmid Preparation:

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.
    Article Snippet: .. Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS ..

    CRISPR:

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.
    Article Snippet: .. Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS ..

    Gene Knockout:

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.
    Article Snippet: .. Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS ..

    Control:

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.
    Article Snippet: .. Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS ..

    esiRNA:

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.
    Article Snippet: .. Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS ..

    shRNA:

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.
    Article Snippet: .. Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS ..

    Construct:

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.
    Article Snippet: .. Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS ..

    Software:

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy.
    Article Snippet: .. Antibodies Mouse anti-human p130cas antibody Lab Vision/Neomarkers, Fremont, CA Cat# MS-855-P1ABX, RRID:AB_145261 Anti-human CD31 monoclonal antibody Dako, Carpinteria, CA Agilent Cat# GA610, RRID:AB_2892053 Anti-VEGF Receptor 2 antibody (ab39256), cytoplasmic portion Abcam Abcam Cat# ab39256, RRID:AB_883437 Anti-VEGF Receptor 2 antibody (ab45010), extracellular domain Abcam Abcam Cat# ab45010, RRID:AB_883436 Bevacizumab Genentech Inc N/A B20, anti-human/murine VEGF A antibody Genentech Inc N/A Recombinant DNA EGFP-LC3B Karla Kirkegaard (Addgene plasmid # 11546) RRID:Addgene_11546 MAP-LC3b2 CRISPR/Cas9 knockout plasmids (Human) Santa Cruz Biotechnology Cat# sc-417828, sc-417828-HDR CASP10 - human gene knockout kit via CRISPR/Cas9 (KN206379) Origene Cat# KN206379 VEGF Receptor 2 (KDR) (NM_002253) Human Tagged ORF Clone Origene Cat# NM_002253 Oligonucleotides Human-specific p130cas siRNA (CAGCATCACGCAGGGCAA) Sigma-Aldrich (St. Louis, MO) NM_014567 Murine-specific p130cas siRNA (TTGACTAATAGTCTACATTA) Sigma-Aldrich (St. Louis, MO) NM_009954 Control non-targeting siRNA (AATTCTCCGAACGTGTCACGT) Sigma-Aldrich (St. Louis, MO) SIC001 MISSION esiRNA human TNKS1BP1 (EHU090681) Sigma-Aldrich (St. Louis, MO) Cat# EHU090681 TNKS1BP1 – Human shRNA constructs in lentiviral vector (TL300907) Origene Cat# TL300907 Experimental models: Organisms/strains Mouse: C57BL/6-p130casflox/flox female and male Dr. Alex Kolodkin, Solomon H. Snyder Department of Neuroscience, Howard Hughes Medical Institute, The Johns Hopkins School of Medicine N/A Mouse: C57BL/6- Tie2-Cre+/- female and male Genetically Engineered Mouse Facility at MD Anderson Cancer Center https://www. mdanderson.org/research/research-resources/ core-facilities/genetically-engineered-mousefacility/mouse-resource-facility.html N/A Female athymic nude mice (NCr-nu) Taconic Model # NCRNU-F Female C57/BL6 mice Taconic Model # B6-F Software and algorithms GraphPad Prism 7.0 GraphPad Software, Inc., San Diego, CA GraphPad Prism, RRID:SCR_002798 Kaplan-Meier survival curves SPSS version 12 for Windows statistical software (SPSS, Inc., Chicago, IL) survival, RRID:SCR_021137 Cell Reports 38, 110301, January 25, 2022 e1 Article ll OPEN ACCESS ..



    Similar Products

    93
    Santa Cruz Biotechnology lc3 crispr cas9 knockout plasmids
    Fig. 6 Effect of autophagy on CS-mediated NLRP3 Inflammasome inhibition in N. gonorrhoeae-infected macrophages. In panel A, J774A.1 macrophages were pre-incubated with CS or a vehicle in the presence or absence of 5 mM 3-MA for 0.5 h before N. gonorrhoeae infection, followed by an additional 24- hour incubation period. Levels of IL-1β in the supernatants were measured through ELISA. In panel B, wild-type or <t>LC3-knockdown</t> J774A.1 macrophages were incubated with 100 nM rapamycin or a vehicle for 4 h, and the levels of LC3 in the cell lysates were assessed via Western blotting. In panels C-E, wild- type or LC3-knockdown J774A.1 macrophages were pre-incubated with either CS or a control vehicle for 0.5 h before N. gonorrhoeae infection, followed by an additional 24-hour incubation period. The concentrations of IL-1β (C) and IL-6 (E) in the supernatants were measured through ELISA, while the levels of caspase-1 in the supernatants were assessed through Western blotting (D). The ELISA data are presented as the mean ± SD of three independent experiments. The presented Western blotting images represent individual experiments. Statistical significance is indicated as ***p < 0.001 as indicated
    Lc3 Crispr Cas9 Knockout Plasmids, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sc+417828/MAP+LC3%CE%B2+HDR+Plasmid/pm39578786-47-16-26
    Average 93 stars, based on 1 article reviews
    lc3 crispr cas9 knockout plasmids - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology mouse lc3 crispr cas9 knockout plasmids
    Role of autophagy in CA-mediated IL-1β inhibition in S. sonnei -infected macrophages. ( A-C ) J774A.1 macrophages were incubated with 40 µM CA for 4–20 h or 1 µM rapamycin for 4 h. The expression levels of <t>LC3</t> ( A ), ATG5 ( B ) and p62 ( C ) in the cell lysates were analysed by Western blotting. ( D ) J774A.1 macrophages were primed for 4 h with LPS in the presence or absence of 1 mM 3-MA, followed by incubation with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. ( E ) Wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 20 h. The expression levels of LC3 in the cell lysates were analysed by Western blotting. ( F ) LPS-primed wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. The Western blotting images are representative of separate experiments. The ELISA data are expressed as the means ± SD of three separate experiments. * p < 0.05 and *** p < 0.001 as indicated
    Mouse Lc3 Crispr Cas9 Knockout Plasmids, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sc+417828/MAP+LC3%CE%B2+CRISPR%2FCas9+KO+Plasmid/pmc11151564-51-0-24
    Average 93 stars, based on 1 article reviews
    mouse lc3 crispr cas9 knockout plasmids - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    90
    OriGene sc 417828 hdr casp10 human gene knockout kit
    Role of autophagy in CA-mediated IL-1β inhibition in S. sonnei -infected macrophages. ( A-C ) J774A.1 macrophages were incubated with 40 µM CA for 4–20 h or 1 µM rapamycin for 4 h. The expression levels of <t>LC3</t> ( A ), ATG5 ( B ) and p62 ( C ) in the cell lysates were analysed by Western blotting. ( D ) J774A.1 macrophages were primed for 4 h with LPS in the presence or absence of 1 mM 3-MA, followed by incubation with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. ( E ) Wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 20 h. The expression levels of LC3 in the cell lysates were analysed by Western blotting. ( F ) LPS-primed wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. The Western blotting images are representative of separate experiments. The ELISA data are expressed as the means ± SD of three separate experiments. * p < 0.05 and *** p < 0.001 as indicated
    Sc 417828 Hdr Casp10 Human Gene Knockout Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sc+417828/Caspase+10+(CASP10)+Human+Gene+Knockout+Kit/pm35081345-219-79-89
    Average 90 stars, based on 1 article reviews
    sc 417828 hdr casp10 human gene knockout kit - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology sc 417828
    Role of autophagy in CA-mediated IL-1β inhibition in S. sonnei -infected macrophages. ( A-C ) J774A.1 macrophages were incubated with 40 µM CA for 4–20 h or 1 µM rapamycin for 4 h. The expression levels of <t>LC3</t> ( A ), ATG5 ( B ) and p62 ( C ) in the cell lysates were analysed by Western blotting. ( D ) J774A.1 macrophages were primed for 4 h with LPS in the presence or absence of 1 mM 3-MA, followed by incubation with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. ( E ) Wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 20 h. The expression levels of LC3 in the cell lysates were analysed by Western blotting. ( F ) LPS-primed wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. The Western blotting images are representative of separate experiments. The ELISA data are expressed as the means ± SD of three separate experiments. * p < 0.05 and *** p < 0.001 as indicated
    Sc 417828, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sc+417828/MAP+LC3%CE%B2+HDR+Plasmid/pm35081345-219-78-74
    Average 93 stars, based on 1 article reviews
    sc 417828 - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology sc 417828 hdr casp10 human gene knockout kit
    Role of autophagy in CA-mediated IL-1β inhibition in S. sonnei -infected macrophages. ( A-C ) J774A.1 macrophages were incubated with 40 µM CA for 4–20 h or 1 µM rapamycin for 4 h. The expression levels of <t>LC3</t> ( A ), ATG5 ( B ) and p62 ( C ) in the cell lysates were analysed by Western blotting. ( D ) J774A.1 macrophages were primed for 4 h with LPS in the presence or absence of 1 mM 3-MA, followed by incubation with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. ( E ) Wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 20 h. The expression levels of LC3 in the cell lysates were analysed by Western blotting. ( F ) LPS-primed wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. The Western blotting images are representative of separate experiments. The ELISA data are expressed as the means ± SD of three separate experiments. * p < 0.05 and *** p < 0.001 as indicated
    Sc 417828 Hdr Casp10 Human Gene Knockout Kit, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sc+417828/MAP+LC3%CE%B2+HDR+Plasmid/pm35081345-219-79-74
    Average 93 stars, based on 1 article reviews
    sc 417828 hdr casp10 human gene knockout kit - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology map lc3β2 grispr gas9 knockout plasmids human
    KEY RESOURCES TABLE
    Map Lc3β2 Grispr Gas9 Knockout Plasmids Human, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sc+417828/MAP+LC3%CE%B2+CRISPR%2FCas9+KO+Plasmid/pmc08860355-12-0-6
    Average 93 stars, based on 1 article reviews
    map lc3β2 grispr gas9 knockout plasmids human - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology sc 417828 hdr
    KEY RESOURCES TABLE
    Sc 417828 Hdr, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sc+417828/MAP+LC3%CE%B2+HDR+Plasmid/pmc08860355-12-12-6
    Average 93 stars, based on 1 article reviews
    sc 417828 hdr - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology crispr cas9 knockout plasmids targeting lc3
    F240B induces autophagy. (A, B) J774A.1 macrophages were incubated for 3–24 h with 0.3 µM F240B or for 4 h with 0.1 µM rapamycin. The levels of <t>LC3</t> (A) and p62 (B) in the lysates were measured by Western blotting. (C) J774A.1 macrophages were incubated for 3 h with 0.1–1 µM F240B or for 4 h with 0.1 µM rapamycin. The levels of p62 in the lysates were measured by Western blotting. (D) GFP-LC3 expressed J774A.1 macrophages were incubated for 3 h with 1 µM F240B or for 4 h with 0.1 µM rapamycin. The LC3-GFP speck formation was measured by confocal microscopy. (E) J774A.1 macrophages were incubated for 3 h with 1 µM F240B. The cells were stained with 50 nM MDC or 1 µg/ml AO and the fluorescent signals were acquired by confocal microscopy.
    Crispr Cas9 Knockout Plasmids Targeting Lc3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sc+417828/MAP+LC3%CE%B2+HDR+Plasmid/pmc07793731-104-12-23
    Average 93 stars, based on 1 article reviews
    crispr cas9 knockout plasmids targeting lc3 - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    Image Search Results


    Fig. 6 Effect of autophagy on CS-mediated NLRP3 Inflammasome inhibition in N. gonorrhoeae-infected macrophages. In panel A, J774A.1 macrophages were pre-incubated with CS or a vehicle in the presence or absence of 5 mM 3-MA for 0.5 h before N. gonorrhoeae infection, followed by an additional 24- hour incubation period. Levels of IL-1β in the supernatants were measured through ELISA. In panel B, wild-type or LC3-knockdown J774A.1 macrophages were incubated with 100 nM rapamycin or a vehicle for 4 h, and the levels of LC3 in the cell lysates were assessed via Western blotting. In panels C-E, wild- type or LC3-knockdown J774A.1 macrophages were pre-incubated with either CS or a control vehicle for 0.5 h before N. gonorrhoeae infection, followed by an additional 24-hour incubation period. The concentrations of IL-1β (C) and IL-6 (E) in the supernatants were measured through ELISA, while the levels of caspase-1 in the supernatants were assessed through Western blotting (D). The ELISA data are presented as the mean ± SD of three independent experiments. The presented Western blotting images represent individual experiments. Statistical significance is indicated as ***p < 0.001 as indicated

    Journal: BMC infectious diseases

    Article Title: Exploring Candesartan, an angiotensin II receptor antagonist, as a novel inhibitor of NLRP3 inflammasome: alleviating inflammation in Neisseria gonorrhoeae infection.

    doi: 10.1186/s12879-024-10208-3

    Figure Lengend Snippet: Fig. 6 Effect of autophagy on CS-mediated NLRP3 Inflammasome inhibition in N. gonorrhoeae-infected macrophages. In panel A, J774A.1 macrophages were pre-incubated with CS or a vehicle in the presence or absence of 5 mM 3-MA for 0.5 h before N. gonorrhoeae infection, followed by an additional 24- hour incubation period. Levels of IL-1β in the supernatants were measured through ELISA. In panel B, wild-type or LC3-knockdown J774A.1 macrophages were incubated with 100 nM rapamycin or a vehicle for 4 h, and the levels of LC3 in the cell lysates were assessed via Western blotting. In panels C-E, wild- type or LC3-knockdown J774A.1 macrophages were pre-incubated with either CS or a control vehicle for 0.5 h before N. gonorrhoeae infection, followed by an additional 24-hour incubation period. The concentrations of IL-1β (C) and IL-6 (E) in the supernatants were measured through ELISA, while the levels of caspase-1 in the supernatants were assessed through Western blotting (D). The ELISA data are presented as the mean ± SD of three independent experiments. The presented Western blotting images represent individual experiments. Statistical significance is indicated as ***p < 0.001 as indicated

    Article Snippet: Antibodies for ASC (SC-22514-R), inducible nitric oxide synthase (iNOS) (sc-7271), cyclooxygenase-2 (COX2) (sc-19999), actin (SC-47778) and LC3 CRISPR/Cas9 knockout plasmids (sc-426563 and sc-417828-HDR) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Inhibition, Infection, Incubation, Enzyme-linked Immunosorbent Assay, Knockdown, Western Blot, Control

    Role of autophagy in CA-mediated IL-1β inhibition in S. sonnei -infected macrophages. ( A-C ) J774A.1 macrophages were incubated with 40 µM CA for 4–20 h or 1 µM rapamycin for 4 h. The expression levels of LC3 ( A ), ATG5 ( B ) and p62 ( C ) in the cell lysates were analysed by Western blotting. ( D ) J774A.1 macrophages were primed for 4 h with LPS in the presence or absence of 1 mM 3-MA, followed by incubation with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. ( E ) Wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 20 h. The expression levels of LC3 in the cell lysates were analysed by Western blotting. ( F ) LPS-primed wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. The Western blotting images are representative of separate experiments. The ELISA data are expressed as the means ± SD of three separate experiments. * p < 0.05 and *** p < 0.001 as indicated

    Journal: Journal of Inflammation (London, England)

    Article Title: Cinnamaldehyde inhibits the NLRP3 inflammasome by preserving mitochondrial integrity and augmenting autophagy in Shigella sonnei -infected macrophages

    doi: 10.1186/s12950-024-00395-w

    Figure Lengend Snippet: Role of autophagy in CA-mediated IL-1β inhibition in S. sonnei -infected macrophages. ( A-C ) J774A.1 macrophages were incubated with 40 µM CA for 4–20 h or 1 µM rapamycin for 4 h. The expression levels of LC3 ( A ), ATG5 ( B ) and p62 ( C ) in the cell lysates were analysed by Western blotting. ( D ) J774A.1 macrophages were primed for 4 h with LPS in the presence or absence of 1 mM 3-MA, followed by incubation with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. ( E ) Wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 20 h. The expression levels of LC3 in the cell lysates were analysed by Western blotting. ( F ) LPS-primed wild-type or LC3-knockdown J774A.1 macrophages were incubated with 40 µM CA for 0.5 h before S. sonnei infection for an additional 21 h. The detectable levels of IL-1β in the supernatants were analysed by ELISA. The Western blotting images are representative of separate experiments. The ELISA data are expressed as the means ± SD of three separate experiments. * p < 0.05 and *** p < 0.001 as indicated

    Article Snippet: Mouse LC3 CRISPR/Cas9 knockout plasmids (sc-426,563 and sc-417,828-HDR) and antibodies against IL-18 (SC-6177), ASC (SC-22,514-R), cathepsin B (SC-365,558) and actin (SC-47,778) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Inhibition, Infection, Incubation, Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Knockdown

    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy

    doi: 10.1016/j.celrep.2022.110301

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: MAP-LC3β2 GRISPR/Gas9 knockout plasmids (Human) , Santa Cruz Biotechnology , Cat# sc-417828, sc-417828-HDR.

    Techniques: Recombinant, Plasmid Preparation, Knock-Out, Gene Knockout, CRISPR, Control, esiRNA, shRNA, Construct, Software

    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy

    doi: 10.1016/j.celrep.2022.110301

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: MAP-LC3β2 GRISPR/Gas9 knockout plasmids (Human) , Santa Cruz Biotechnology , Cat# sc-417828, sc-417828-HDR.

    Techniques: Recombinant, Plasmid Preparation, Knock-Out, Gene Knockout, CRISPR, Control, esiRNA, shRNA, Construct, Software

    F240B induces autophagy. (A, B) J774A.1 macrophages were incubated for 3–24 h with 0.3 µM F240B or for 4 h with 0.1 µM rapamycin. The levels of LC3 (A) and p62 (B) in the lysates were measured by Western blotting. (C) J774A.1 macrophages were incubated for 3 h with 0.1–1 µM F240B or for 4 h with 0.1 µM rapamycin. The levels of p62 in the lysates were measured by Western blotting. (D) GFP-LC3 expressed J774A.1 macrophages were incubated for 3 h with 1 µM F240B or for 4 h with 0.1 µM rapamycin. The LC3-GFP speck formation was measured by confocal microscopy. (E) J774A.1 macrophages were incubated for 3 h with 1 µM F240B. The cells were stained with 50 nM MDC or 1 µg/ml AO and the fluorescent signals were acquired by confocal microscopy.

    Journal: Frontiers in Immunology

    Article Title: A Synthetic Small Molecule F240B Decreases NLRP3 Inflammasome Activation by Autophagy Induction

    doi: 10.3389/fimmu.2020.607564

    Figure Lengend Snippet: F240B induces autophagy. (A, B) J774A.1 macrophages were incubated for 3–24 h with 0.3 µM F240B or for 4 h with 0.1 µM rapamycin. The levels of LC3 (A) and p62 (B) in the lysates were measured by Western blotting. (C) J774A.1 macrophages were incubated for 3 h with 0.1–1 µM F240B or for 4 h with 0.1 µM rapamycin. The levels of p62 in the lysates were measured by Western blotting. (D) GFP-LC3 expressed J774A.1 macrophages were incubated for 3 h with 1 µM F240B or for 4 h with 0.1 µM rapamycin. The LC3-GFP speck formation was measured by confocal microscopy. (E) J774A.1 macrophages were incubated for 3 h with 1 µM F240B. The cells were stained with 50 nM MDC or 1 µg/ml AO and the fluorescent signals were acquired by confocal microscopy.

    Article Snippet: Antibodies against Actin (sc-47778), ASC (sc-25514-R), cyclooxygenase-2 (COX-2) (sc-376861), phospho-IκB-α (sc-8404) and CRISPR/Cas9 knockout plasmids targeting LC3 (sc-426563 and sc-417828-HDR) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Incubation, Western Blot, Confocal Microscopy, Staining

    F240B inhibits the NLRP3 inflammasome through autophagy induction. (A, B) J774A.1 macrophages were incubated with 1 µg/ml LPS for 5 h followed by incubated with F240B for 3 h. Cells then incubated with 5 mM ATP for 0.5 h. The levels of IL-1β and caspase-1 (A) or NLRP3 and ASC (B) in the supernatants were measured by Western blotting. (C) J774A.1 macrophages were incubated with 1 µg/ml LPS for 5 h followed by incubated with 1 µM F240B in the presence or absence of 5 mM 3-MA for 3 h. Cells then were incubated with 5 mM ATP or 10 μM nigericin for 0.5 h. The levels of IL-1β in the supernatants were measured by ELISA. (D) Wild-type and LC3-knockout J774A.1 macrophages were incubated with 1 µg/ml LPS for 5 h followed by incubated with 1 µM F240B for 3 h. Cells then incubated with 5 mM ATP or 10 μM nigericin for 0.5 h. The levels of IL-1β in the supernatants were measured by ELISA. The data are expressed as the mean ± SD of three separate experiments. * and *** indicate a significant difference at the level of p < 0.05 and p < 0.001, respectively.

    Journal: Frontiers in Immunology

    Article Title: A Synthetic Small Molecule F240B Decreases NLRP3 Inflammasome Activation by Autophagy Induction

    doi: 10.3389/fimmu.2020.607564

    Figure Lengend Snippet: F240B inhibits the NLRP3 inflammasome through autophagy induction. (A, B) J774A.1 macrophages were incubated with 1 µg/ml LPS for 5 h followed by incubated with F240B for 3 h. Cells then incubated with 5 mM ATP for 0.5 h. The levels of IL-1β and caspase-1 (A) or NLRP3 and ASC (B) in the supernatants were measured by Western blotting. (C) J774A.1 macrophages were incubated with 1 µg/ml LPS for 5 h followed by incubated with 1 µM F240B in the presence or absence of 5 mM 3-MA for 3 h. Cells then were incubated with 5 mM ATP or 10 μM nigericin for 0.5 h. The levels of IL-1β in the supernatants were measured by ELISA. (D) Wild-type and LC3-knockout J774A.1 macrophages were incubated with 1 µg/ml LPS for 5 h followed by incubated with 1 µM F240B for 3 h. Cells then incubated with 5 mM ATP or 10 μM nigericin for 0.5 h. The levels of IL-1β in the supernatants were measured by ELISA. The data are expressed as the mean ± SD of three separate experiments. * and *** indicate a significant difference at the level of p < 0.05 and p < 0.001, respectively.

    Article Snippet: Antibodies against Actin (sc-47778), ASC (sc-25514-R), cyclooxygenase-2 (COX-2) (sc-376861), phospho-IκB-α (sc-8404) and CRISPR/Cas9 knockout plasmids targeting LC3 (sc-426563 and sc-417828-HDR) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Incubation, Western Blot, Enzyme-linked Immunosorbent Assay, Knock-Out

    Activation of autophagy by F240B inhibits NF-κB activation and proIL-1β expression. (A) J774A.1 macrophages were incubated with F240B for 0.5 h followed by incubated with 1 µg/ml LPS for 6 h. The levels of proIL-1β and NLRP3 in the cell lysates were measured by Western blotting. (B) J-Blue cells were incubated with F240B for 0.5 h followed by incubated with 1 µg/ml LPS for 24 h. The NF-κB transcriptional activity was measured by NF-κB reporter assay. (C, D) J774A.1 macrophages were incubated with F240B (1 µM for ROS assay) for 0.5 h followed by incubated with 1 µg/ml LPS for 10 min. The phosphorylation levels of IκBα in the cell lysates were measured by Western blotting (C) , and the intracellular ROS production was analysed by H 2 DCFDA staining (D) . (E) J774A.1 macrophages were incubated with 1 µM F240B for 0.5 h followed by incubated with 1 µg/ml LPS for 10-30 min. The phosphorylation levels of ERK1/2, JNK1/2 and p38 in the cell lysates were measured by Western blotting. (F) Will-type or LC3-knockout J774A.1 macrophages were incubated with1 µM F240B for 0.5 h followed by incubated with 1 µg/ml LPS for 6 h. The levels of proIL-1β in the cell lysates were measured by Western blotting. ** and *** indicate a significant difference at the level of p < 0.01 and p < 0.001, respectively compared to LPS.

    Journal: Frontiers in Immunology

    Article Title: A Synthetic Small Molecule F240B Decreases NLRP3 Inflammasome Activation by Autophagy Induction

    doi: 10.3389/fimmu.2020.607564

    Figure Lengend Snippet: Activation of autophagy by F240B inhibits NF-κB activation and proIL-1β expression. (A) J774A.1 macrophages were incubated with F240B for 0.5 h followed by incubated with 1 µg/ml LPS for 6 h. The levels of proIL-1β and NLRP3 in the cell lysates were measured by Western blotting. (B) J-Blue cells were incubated with F240B for 0.5 h followed by incubated with 1 µg/ml LPS for 24 h. The NF-κB transcriptional activity was measured by NF-κB reporter assay. (C, D) J774A.1 macrophages were incubated with F240B (1 µM for ROS assay) for 0.5 h followed by incubated with 1 µg/ml LPS for 10 min. The phosphorylation levels of IκBα in the cell lysates were measured by Western blotting (C) , and the intracellular ROS production was analysed by H 2 DCFDA staining (D) . (E) J774A.1 macrophages were incubated with 1 µM F240B for 0.5 h followed by incubated with 1 µg/ml LPS for 10-30 min. The phosphorylation levels of ERK1/2, JNK1/2 and p38 in the cell lysates were measured by Western blotting. (F) Will-type or LC3-knockout J774A.1 macrophages were incubated with1 µM F240B for 0.5 h followed by incubated with 1 µg/ml LPS for 6 h. The levels of proIL-1β in the cell lysates were measured by Western blotting. ** and *** indicate a significant difference at the level of p < 0.01 and p < 0.001, respectively compared to LPS.

    Article Snippet: Antibodies against Actin (sc-47778), ASC (sc-25514-R), cyclooxygenase-2 (COX-2) (sc-376861), phospho-IκB-α (sc-8404) and CRISPR/Cas9 knockout plasmids targeting LC3 (sc-426563 and sc-417828-HDR) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Activation Assay, Expressing, Incubation, Western Blot, Activity Assay, Reporter Assay, ROS Assay, Phospho-proteomics, Staining, Knock-Out

    Activation of autophagy by F240B limits mitochondrial integrity loss. (A) J774A.1 macrophages were incubated with 1 µg/ml LPS for 5 h followed by incubated with 1 µM F240B in the presence or absence of 5 mM 3-MA for 3 h. Cells then incubated with 5 mM ATP for 0.5 h. (B) Wild-type or LC3-knockout J774A.1 macrophages were incubated with 1 µg/ml LPS for 5 h followed by incubated with 1 µM F240B for 3 h. Cells then incubated with 5 mM ATP for 0.5 h. The mitochondrial membrane integrity was measured by staining with MitoTracker Deep Red and MitoTracker Green. The percentage of cells with mitochondrial membrane integrity loss are expressed as the mean ± SD of three separate experiments. * and ** indicate a significant difference at the level of p < 0.05 and p < 0.01, respectively.

    Journal: Frontiers in Immunology

    Article Title: A Synthetic Small Molecule F240B Decreases NLRP3 Inflammasome Activation by Autophagy Induction

    doi: 10.3389/fimmu.2020.607564

    Figure Lengend Snippet: Activation of autophagy by F240B limits mitochondrial integrity loss. (A) J774A.1 macrophages were incubated with 1 µg/ml LPS for 5 h followed by incubated with 1 µM F240B in the presence or absence of 5 mM 3-MA for 3 h. Cells then incubated with 5 mM ATP for 0.5 h. (B) Wild-type or LC3-knockout J774A.1 macrophages were incubated with 1 µg/ml LPS for 5 h followed by incubated with 1 µM F240B for 3 h. Cells then incubated with 5 mM ATP for 0.5 h. The mitochondrial membrane integrity was measured by staining with MitoTracker Deep Red and MitoTracker Green. The percentage of cells with mitochondrial membrane integrity loss are expressed as the mean ± SD of three separate experiments. * and ** indicate a significant difference at the level of p < 0.05 and p < 0.01, respectively.

    Article Snippet: Antibodies against Actin (sc-47778), ASC (sc-25514-R), cyclooxygenase-2 (COX-2) (sc-376861), phospho-IκB-α (sc-8404) and CRISPR/Cas9 knockout plasmids targeting LC3 (sc-426563 and sc-417828-HDR) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Activation Assay, Incubation, Knock-Out, Membrane, Staining